Introduction
Adhesive capsulitis (AC), commonly known as frozen shoulder (FS), is a prevalent musculoskeletal disorder characterized by insidious onset of pain, including nocturnal exacerbation, and a progressive, significant restriction in both active and passive ranges of motion (ROM) of the glenohumeral joint, ultimately leading to substantial functional impairment.1 This limitation in mobility severely impacts patients’ daily activities, functional independence, and overall quality of life.2 The estimated prevalence of FS in the general population ranges from 2% to 5%, with a higher incidence observed in women and individuals aged 40–60 years3 The resultant disability imposes a considerable burden on healthcare systems and society.
The primary pathomechanism of FS is considered to involve inflammation of the intra-articular synovium followed by fibrosis of the shoulder joint capsule.4 Supporting this, Akbar et al.5 demonstrated elevated levels of pro-inflammatory proteins, such as IL-6, IL-8, and chemokine (C-C motif) ligand (CCL)-20, produced by fibroblasts cultured from FS capsules compared to control fibroblasts, indicating a role for activated fibroblasts in modulating inflammatory and fibrotic processes in FS. Concurrently, activated fibroblasts contribute to collagen deposition and reduced matrix degradation,6 culminating in capsular thickening and contracture as the fibrotic process progresses.7
Increasing attention has been directed toward the potential involvement of systemic metabolic and immune disorders in the pathogenesis of FS.8 Notably, conditions, such as diabetes mellitus, thyroid dysfunction, and chronic musculoskeletal diseases have been implicated.9 Recent investigations have highlighted a significant association between dyslipidemia and FS, suggesting hyperlipidemia as a potential risk factor. Bunker and Esler10 initially proposed hyperlipidemia as a risk factor for adhesive capsulitis, and Sun et al.11 further identified hyperlipidemia as a significant risk factor for the development of FS. Notably, Sung et al.12 reported a significant association between hypercholesterolemia and inflammatory lipoproteinemia, particularly very-low-density lipoproteinemia and high non-high-density lipoprotein cholesterolemia, with primary adhesive capsulitis.
Consistent with this, Wang et al.13 found that patients with hyperlipidemia had a 1.5-fold higher risk of developing adhesive capsulitis compared to healthy controls.
Several potential mechanisms have been proposed to elucidate the link between hyperlipidemia and FS. In individuals with dyslipidemia, elevated levels of pro-inflammatory cytokines, including interleukins and tumor necrosis factor-α, are commonly observed, potentially promoting the development of primary adhesive capsulitis via inflammatory pathways.6,14 Furthermore, alterations in lipid metabolism can affect the function of the shoulder joint synovial tissue.15 Lipids influence the integrity of cell membranes and signaling pathways, including those associated with peroxisome proliferator-activated receptors and the NF-κB pathway, both of which play crucial roles in inflammation and fibrosis.16 Notably, low-density lipoprotein (LDL) and its oxidized form (ox-LDL) have been implicated as key drivers of pro-inflammatory responses in hyperlipidemia across various tissues, including tendons.17
While the association between hyperlipidemia and FS is increasingly recognized, the underlying molecular mechanisms remain incompletely understood. Elucidating how dysregulated lipid metabolism contributes to the inflammatory and fibrotic processes within the shoulder joint capsule is critical for the development of targeted therapeutic interventions. Our study aims to further clarify these mechanisms by investigating the specific molecular pathways and mediators potentially involved in the interplay between hyperlipidemia and FS.
Results
Hyperlipidemia induces shoulder joint fibrosis and mimics pathological features of frozen shoulder in rats
To establish a rat model of hyperlipidemia-induced FS, Sprague-Dawley rats were subjected to a high-fat diet for 12 weeks. Serum lipid profiles were assessed at 4, 8, and 12 weeks post-diet initiation. As depicted in Figure 1A, rats in the hyperlipidemia (HL) group exhibited a significant time-dependent increase in serum total cholesterol (TC), triglycerides (TG), and low-density lipoprotein (LDL) levels, accompanied by a significant decrease in high-density lipoprotein (HDL) levels, when compared to the normal control (NC) group (p < 0.01 at 12 weeks for all parameters).
These results confirmed the successful establishment of the hyperlipidemia rat model. Subsequently, shoulder joint mobility was evaluated by measuring the maximum abduction angle. As shown in Figure 1B, the HL group demonstrated a significant reduction in shoulder joint abduction angle compared to the NC group at 8 and 12 weeks (p < 0.01), indicating the successful development of restricted joint movement characteristic of FS.
Pathological changes in the shoulder joints were examined histologically. Hematoxylin and eosin (H&E) staining of shoulder joint tissues at 8 weeks revealed marked synovial thickening, vascular congestion, and substantial inflammatory cell infiltration (As shown by the arrow) in the HL group compared to the NC group (Figure 1C). We detected the distribution of inflammatory cells (CD68+) by immunofluorescence staining, and the results were consistent with the hematoxylin and eosin (H&E) staining, showing inflammatory cell infiltration in the high-fat group at 8 weeks (Figure S1A).
Masson’s trichrome staining further demonstrated a significant increase in collagen fiber deposition and an enhanced degree of capsular fibrosis in the HL group at 8 weeks (Figure 1D). Immunohistochemical analysis of the shoulder joint capsules at 12 weeks showed a significant upregulation of both Collagen-I (Col-I) and Collagen-III (Col-III) expression in the HL group compared to the NC group (Figure 1E). These pathological alterations closely resembled the characteristic features observed in clinical FS patients, confirming the successful establishment of a hyperlipidemia-induced animal model that mimics the pathological features of FS.Figure 1Hyperlipidemia-induced rat model exhibits pathological features of frozen shoulder(A) Serum lipid profiles, including total cholesterol (TC), triglycerides (TG), low-density lipoprotein (LDL), and high-density lipoprotein (HDL), in normal control (NC) and hyperlipidemic (HL) rats over 12 weeks.(B) Shoulder joint range of motion in NC and HL rats over 12 weeks.(C) Hematoxylin and eosin (H&E) staining of shoulder joints from NC and HL rats.
Scale bars, 50 μm.(D) Masson’s trichrome staining of shoulder joint capsules from NC and HL rats. Scale bars, 50 μm.(E) Immunohistochemical staining of collagen-I (Col-I) and collagen-III (Col-III) in shoulder joint capsules from NC and HL rats. Scale bars, 50 μm. n = 6 biologically independent rats per group.
Data are represented as mean ± SD. Statistical analyses were performed using Student’s t tests for two groups. ∗p < 0.05, ∗∗p < 0.01 and ∗∗∗p < 0.001.
Hyperlipidemia induces shoulder joint synovial fibrosis and upregulates TNC expression in the synovium
To investigate the molecular mechanisms underlying hyperlipidemia-induced FS, we performed transcriptome sequencing on shoulder joint capsule tissues from rats subjected to a 12-week high-fat diet and normal control rats. The analysis identified a total of 545 differentially expressed genes (DEGs) in the hyperlipidemia (HL) group compared to the normal control (NC) group, with 374 genes significantly upregulated and 171 genes significantly downregulated (Figure 2A). A volcano plot visually represented the expression patterns of these DEGs, among them, the genes of the collagen and integrin families showed significant upregulation (Figure 2B).
Gene ontology (GO) enrichment analysis revealed that these DEGs were significantly enriched in biological processes, such as extracellular matrix organization, inflammatory response, and signal transduction (Figure 2C). Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis indicated that the DEGs were primarily involved in pathways including the PI3K-Akt signaling pathway and ECM-receptor interaction (Figure 2D).Figure 2Transcriptomic analysis and histological validation of shoulder joint capsule tissue in hyperlipidemic rats(A) Heatmap displaying differentially expressed genes in shoulder joint capsule tissue of normal control (NC) and hyperlipidemic (HL) rats.(B) Volcano plot showing the distribution of differentially expressed genes in shoulder joint capsule tissue of HL rats compared to NC rats.(C) Bar graph illustrating the top 30 enriched gene ontology (GO) terms for differentially expressed genes in shoulder joint capsule tissue of HL rats.(D) Bar graph illustrating the top 30 enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways for differentially expressed genes in shoulder joint capsule tissue of HL rats.(E) Protein-protein interaction (PPI) network of differentially expressed genes in shoulder joint capsule tissue of HL rats.(F) Prediction of potential TNC transcription factors.(G) Dual-luciferase reporter assay results examining the effect of TBX5 overexpression on the transcriptional activity of wild-type (WT) and mutant (MUT) TNC promoters. ∗∗p < 0.01(vs. pcDNA3.1-NC + pGL4.11-TNC-3′UTR-WT), ##p < 0.01(vs. pcDNA3.1-TBX5 + pGL4.11-TNC-3′UTR-WT).(H) Chromatin immunoprecipitation followed by quantitative PCR (ChIP-qPCR) experiment validating the direct binding of the TBX5 protein to specific regions of the TNC promoter.(I) Representative images of hematoxylin and eosin (H&E) stained shoulder joint capsule tissue sections from NC and HL rats.(J) Representative images of Masson’s trichrome stained shoulder joint capsule tissue sections from NC and HL rats.(K) Quantitative real-time PCR (qPCR) analysis of mRNA expression levels of selected genes in shoulder joint tissue of NC and HL rats.(L) Western blot analysis of protein expression levels of selected proteins in shoulder joint tissue of NC and HL rats. n = 3 biologically independent rats per group for transcriptomic analysis (A–E). n = 3 biologically independent experiments (G–H). n = 6 biologically independent rats per group (I–L). Data are represented as mean ± SD.
Statistical analyses were performed using Student’s t tests for two groups (H, K, and L) and one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons (G). ∗p < 0.05, ∗∗p < 0.01 and ∗∗∗p < 0.001.
Protein-protein interaction (PPI) network analysis revealed an extracellular matrix (ECM) remodeling network centered around collagen proteins (such as Col1a1, Col3a1, and Col2a1) and integrins (including Itgα2, Itgα10, and Itgα11) (Figure 2E). Collagen deposition is a core pathological hallmark of fibrosis,18 and the significant upregulation of collagen proteins in the PPI network interaction map suggests that a high-fat diet can induce fibrotic changes in the shoulder joints of SD rats. Integrins serve as key bridge molecules connecting the intracellular cytoskeleton to the external collagen matrix, regulating cell survival, proliferation, and migration through bidirectional signal transduction.19 The extensive interactions between integrins and collagen proteins observed in the PPI network further indicate that a high-fat diet may modulate fibroblast perception of the collagen matrix by influencing the activation state of integrins.
Notably, the matrix regulatory protein TNC exhibits high-degree node interactions with integrins. Furthermore, studies have indicated that multiple transcription factors may regulate TNC expression. Therefore, we predicted potential transcription factors of TNC (Figure 2F).
Among them, TBX5 is a critical transcription factor involved in organogenesis and limb development.20 Meanwhile, studies have shown that knockout of TBX5 in synovial cells can suppress the production of various inflammatory factors, thereby controlling arthritis.21 Therefore, TBX5 was selected for further investigation. Subsequently, we validated this using a dual-luciferase reporter assay. The results showed that the luciferase activity in the pcDNA3.1-TBX5 + pGL4.11-TNC-3′UTR-WT group was significantly enhanced compared to its control group, while mutation of the TBX5 binding site led to a significant decrease in luciferase activity, indicating that TBX5 specifically binds to the TNC promoter and enhances its transcriptional activity (Figure 2G).
In the ChIP-qPCR experiment, the enrichment of TNC mRNA in the IP group was significantly higher than that in the Input group, demonstrating that TBX5 can directly bind to the TNC promoter (Figure 2H). This implies that the TBX5-TNC-Itgα2 molecular axis may play a critical role in the pathogenesis of hyperlipidemia-induced FS.
To validate the transcriptome data, we performed H&E、Immunofluorescence and Masson’s trichrome staining on shoulder joint capsule tissues. The results showed that the HL group exhibited significant inflammatory cell infiltration, collagen fiber hyperplasia, and neovascularization in the shoulder joint capsule compared to the NC group (Figures 2I, 2J, and S1B). These pathological changes were consistent with the alterations in the expression of genes related to extracellular matrix remodeling and inflammatory response observed in the transcriptome sequencing data, further confirming the fibrogenic effect of hyperlipidemia on the shoulder joint synovium.
To further validate the expression changes of key genes identified in the transcriptome analysis, we conducted quantitative real-time PCR (qPCR) and western blot experiments on shoulder joint tissues. The results demonstrated that the mRNA and protein expression levels of TBX5, CEBPD, TNC, TGF-β1, Smad2, and Smad3 were significantly upregulated (p < 0.05), while the mRNA expression levels of GRHL2 and BARX2 were significantly downregulated (p < 0.05) in the HL group compared to the NC group. There was no significant difference in the protein expression levels of Smad2/3 between the two groups (p > 0.05) (Figures 2K and 2L).
To enhance clinical relevance, serum levels of LDL and TNC were measured in both healthy controls and hyperlipidemia patients. Elevated levels of both LDL and TNC were observed in the hyperlipidemia group compared to controls, revealing a positive correlation between circulating lipid and TNC levels (Figure S1C).
In summary, hyperlipidemia-induced FS appears to be closely associated with extracellular matrix remodeling and inflammatory responses. Transcriptomic analysis and experimental validation revealed the upregulation of extracellular matrix proteins such as TNC, as well as the activation of the PI3K-Akt and TGF-β/Smad signaling pathways, which likely play important roles in the development and progression of FS. The TBX5-TNC-Itgα2 molecular axis may represent a crucial pathway in the pathogenesis of hyperlipidemia-induced FS, with TNC, a key downstream target of TBX5, playing a pivotal role in this process.
Tables 1 and 2 provide specific information regarding the primer sequences for all genes.Table 1Primer sequencesPrimer namesSequencesr-TBX5-FAGCAGGGCATGGAAGGAATCr-TBX5-RATAAAGGCGACCCGGCATAGr-CEBPD-FGGCCTTAGAGACTCCGAACGr-CEBPD-RAAACTGTAGCAATTCGGGCGr-GRHL2-FCTTGGGCTTAGCTGCAAACGr-GRHL2-RCTCTGGTTTGTCTCCGGACCr-BARX2-FAATGAACAGTCAGGCCCAGAGr-BARX2-RGACAGCAAGCGCTCCTCTACr-TNC-FACCATGGGGAGTCAGCCTATr-TNC-RCACCTGCCGTTCCACTGTATr-TGF-β1-FAGGGCTACCATGCCAACTTCr-TGF-β1-RCCACGTAGTAGACGATGGGCr-Smad2-FGGCTGTTTCTGAGTGTGGATTGr-Smad2-RTCACCACTGGCGGAGTGAATr-Smad3-FCGACCACCAGATGAACCACAr-Smad3-RAATGTCTCCCCAACTCGCTGh-Itgα2-FGTTTGGCTATGCAGTGCAGCh-Itgα2-RCGGTTCTCAGGAAAGCCACTh- TBX5-FGAGGCCTGCTTCACAACAGAh-TBX5-RTAGCGTGAATGTGGCTGGTTh-TNC-FTCTCGCCCATCGGAAAGAAAh-TNC-RCTGGTTCTCTTCTGGCAGGGh-TGF-β1GGCCCTGTACAACCAGCATAh-TGF-β1ATCCGCAGTCCTCTCTCCATh-Smad2-FCCCGACACACCGAGATCCTAh-Smad2-RGAGATAGTTCTGCTGGAGAGCCh-Smad3-FCTTGGACCTGCAGCCAGTTAh-Smad3-RGGTGAAGCCATCCACAGTCATable 2Primer sequencesPrimer namesSequencesP1-FATCCTACTCCCTCTTGCTCCP1-RCTCTGTAATGGGACGCCTCGP2-FACTGAGCTTCTATGATACCCAAGP2-RCTGATCTGACTTCACTATGGAGP3-FAGGAAGCAGGGGATTCCATGP3-RCAGAGCTTCCTGCCAAAGAC
TNC promotes hyperlipidemia-induced synovial fibroblast activation and migration via the TGF-β/Smad2/3 signaling pathway
To investigate the regulatory mechanism of TNC in hyperlipidemia-induced FS, human rheumatoid arthritis synovial fibroblasts (RASFs) were stimulated with 50 μg/mL oxidized low-density lipoprotein (ox-LDL) to mimic the hyperlipidemic microenvironment. The results revealed a significant upregulation in the mRNA and protein expression levels of TBX5, TNC, TGF-β1, Smad2, and Smad3 in RASFs following ox-LDL stimulation compared to the unstimulated control group (p < 0.05) (Figures 3A and 3B), indicating that ox-LDL can induce the expression of these genes. To further explore the effect of TNC on the TGF-β/Smad2/3 signaling pathway, TNC was overexpressed in RASFs.
Compared to the control group, TNC overexpression significantly increased the mRNA expression levels of TGF-β1, Smad2, and Smad3 (p < 0.05), as well as the protein expression levels of TGF-β1 and phosphorylated Smad2/3(p-Smad2/3) (p < 0.05). Notably, no significant difference was observed in these parameters between the TNC overexpression group and the 50 μg/mL ox-LDL stimulation group (p > 0.05) (Figures 3C and 3D), suggesting that TNC can activate the TGF-β/Smad2/3 signaling pathway, with an effect comparable to ox-LDL stimulation. Immunocytochemical staining results showed increased expression of α-SMA, COL-I, and COL-III in the cytoplasm of cells in both the ox-LDL-stimulated group and the TNC-overexpressing group (Figures 3E and S2A).
Furthermore, scratch assays demonstrated a significant enhancement in the migration ability of synovial fibroblasts after both ox-LDL and TNC stimulation. Compared to the untreated control group (NC), the wound healing rate at 6 h was significantly higher in both the ox-LDL group and the TNC overexpression group (p < 0.01) (Figure 3F), indicating that both ox-LDL and TNC promote synovial fibroblast migration. Collectively, these results suggest that TNC promotes the activation and migration of synovial fibroblasts by activating the TGF-β/Smad2/3 signaling pathway, thereby contributing to the pathogenesis of hyperlipidemia-induced FS.
TNC may represent a potential therapeutic target for the treatment of FS associated with hyperlipidemia.Figure 3TNC promotes synovial fibroblast activation and migration via activation of the TGF-β/Smad2/3 signaling pathway(A) mRNA expression levels of TBX5, TNC, TGF-β1, Smad2, and Smad3 in human rheumatoid arthritis synovial fibroblasts (RASFs) stimulated with oxidized low-density lipoprotein (ox-LDL).(B) Protein expression levels of TBX5, TNC, TGF-β1, Smad2/3, and phosphorylated Smad2/3 (p-Smad2/3) in RASFs stimulated with ox-LDL, as determined by Western blot.(C) mRNA expression levels of TGF-β1, Smad2, and Smad3 in human synovial fibroblasts overexpressing TNC.(D) Protein expression levels of TGF-β1 and p-Smad2/3 in human synovial fibroblasts overexpressing TNC, as determined by western blot.(E) Immunocytochemical staining of α-SMA, COL-I, and COL-III in RASFs under normal control (NC), ox-LDL stimulation, and TNC overexpression conditions. Scale bars, 50 μm.(F) Representative images from scratch assays showing the migration of human synovial fibroblasts under normal control (NC), ox-LDL stimulation, and TNC overexpression conditions at 0 and 6 h. The bar graph on the right quantifies the migration rate.
Scale bars, 100 μm. n = 3 biologically independent experiments. Data are represented as mean ± SD. Statistical analyses were performed using Student’s t tests for two groups (A and B) and one-way ANOVA for multiple comparisons (C, D, and F). ∗p < 0.05, ∗∗p < 0.01 and ∗∗∗p < 0.001.
TNC interacts with Itgα2 to regulate the TGF-β/Smad2/3 signaling pathway and induce frozen shoulder fibrosis
To further elucidate the molecular mechanism of TNC in hyperlipidemia-induced FS, we investigated the interaction between TNC and integrin α2 (Itgα2). Co-immunoprecipitation (Co-IP) experiments revealed in RASFs confirmed a direct interaction between TNC and Itgα2 (Figure 4A). Reciprocal Co-IP experiments further confirmed the interaction between Itgα2 and TNC (Figure 4B).
To clarify the functional significance of this interaction, we manipulated the expression of Itgα2 in synovial-fibroblasts. The results showed that overexpression of Itgα2 significantly upregulated the mRNA and protein expression levels of TGF-β1, Smad2, and Smad3, and increased the phosphorylation levels of Smad2/3. Conversely, knockdown of Itgα2 inhibited the expression of these molecules (Figures 4C and 4D).
Immunocytochemical staining demonstrated that Itgα2 overexpression led to increased expression of α-SMA, COL-I, and COL-III, markers of fibroblast activation and extracellular matrix production (Figures 4E and S2B). Furthermore, scratch assays showed that Itgα2 overexpression significantly enhanced fibroblast migration, with the OE-Itgα2 group exhibiting the highest migration rate, followed by the vector control group, while the Itgα2 knockdown group displayed the lowest migration rate compared to the other two groups (Figure 4F).Figure 4Interaction between TNC and Itgα2 regulates the TGF-β/Smad2/3 signaling pathway and fibroblast behavior(A) Co-immunoprecipitation (CoIP) assay showing the interaction between TNC and Itgα2 in synovial fibroblasts.(B) Reverse CoIP assay confirming the interaction between Itgα2 and TNC in synovial fibroblasts.(C) mRNA expression levels of Itgα2, TGF-β1, Smad2, and Smad3 in synovial fibroblasts with Itgα2 overexpression, Itgα2 knockdown, and negative control.(D) Protein expression levels of Itgα2, TGF-β1, phosphorylated Smad2/3 (p-Smad2/3), and Smad2/3 in synovial fibroblasts with Itgα2 overexpression, Itgα2 knockdown, and negative control, as determined by western blot.(E) Immunocytochemical staining of α-SMA, COL-I, and COL-III in synovial fibroblasts with Itgα2 overexpression, Itgα2 knockdown, and negative control. Scale bars, 50 μm.(F) Representative images from scratch assays showing the migration of synovial fibroblasts with Itgα2 overexpression, Itgα2 knockdown, and negative control at 0 and 6 h.
The bar graph on the right quantifies the migration rate. Scale bars, 100 μm.(G) mRNA expression levels of Itgα2, TGF-β1, Smad2, and Smad3 in synovial fibroblasts with Itgα2 overexpression, Itgα2 knockdown, and negative control under ox-LDL stimulation.(H) Protein expression levels of Itgα2, TGF-β1, phosphorylated Smad2/3 (p-Smad2/3), and Smad2/3 in synovial fibroblasts with Itgα2 overexpression, Itgα2 knockdown, and negative control under ox-LDL stimulation, as determined by western blot.(I) Immunocytochemical staining of α-SMA, COL-I, and COL-III in synovial fibroblasts with Itgα2 overexpression, Itgα2 knockdown, and negative control under ox-LDL stimulation. Scale bars, 50 μm.(J) Representative images from scratch assays showing the migration of synovial fibroblasts with Itgα2 overexpression, Itgα2 knockdown, and negative control under ox-LDL stimulation at 0 and 6 h.
The bar graph on the right quantifies the migration rate. Scale bars, 100 μm. n = 3 biologically independent experiments. Data are represented as mean ± SD and were analyzed using one-way ANOVA. ∗p < 0.05, ∗∗p < 0.01 and ∗∗∗p < 0.001.
To further investigate the role of TNC in the context of hyperlipidemia, we co-cultured fibroblasts with overexpressed or knocked down Itgα2 with ox-LDL. The results showed that overexpression of Itgα2 further enhanced the ox-LDL-induced upregulation of TGF-β1, Smad2, and Smad3 mRNA and protein expression levels, as well as the increased phosphorylation of Smad2/3, compared to the control group (Figures 4G and 4H). Immunocytochemical staining revealed a significant increase in the expression of α-SMA, COL-I, and COL-III in fibroblasts with Itgα2 overexpression (Figures 4I and S2C), indicating increased extracellular matrix synthesis.
Scratch assay results further confirmed that overexpression of Itgα2 significantly enhanced the migration ability of fibroblasts (Figure 4J).
These findings indicate that TNC plays a crucial role in activating the TGF-β/Smad2/3 signaling pathway by interacting with Itgα2, thereby leading to fibroblast activation, extracellular matrix production, and cell migration, ultimately exacerbating FS fibrosis.
TBX5 regulates the TGF-β/Smad2/3 signaling pathway via TNC to promote frozen shoulder fibrosis
To explore the upstream regulators of TNC, we predicted TBX5 as a potential transcription factor binding to the TNC promoter region based on the animal TFDB database and differentially expressed transcription factors identified in our transcriptome sequencing data. Dual-luciferase reporter assays demonstrated that overexpression of TBX5 significantly enhanced the luciferase activity of pGL4.11-WT (wild-type TNC promoter) but had no significant effect on pGL4.11-MUT (mutant TNC promoter) (Figure 5A). Chromatin immunoprecipitation (ChIP) assays confirmed that TBX5 protein specifically bound to the TNC promoter region, showing a marked increase in the abundance of TBX5 gene and protein in the TNC pull-down products (Figures 5B and 5C).
These results indicate that TBX5 directly binds to the TNC promoter to regulate its expression.Figure 5TBX5 regulates TNC and the TGF-β/Smad2/3 signaling pathway(A) Dual-luciferase reporter assay examining the effect of TBX5 overexpression on wild-type and mutant TNC promoter activity. ∗∗p < 0.01, ##p < 0.01.(B) Chromatin immunoprecipitation followed by quantitative PCR (ChIP-qPCR) showing TBX5 binding to different regions of the TNC promoter. ∗∗p < 0.01.(C) Chromatin immunoprecipitation followed by western blot (ChIP-western blot) confirming TBX5 enrichment at the TNC promoter. ∗∗p < 0.01.(D) Quantitative real-time PCR (qPCR) analysis of mRNA expression levels of TNC, TGF-β1, Smad2, and Smad3 in synovial fibroblasts with TBX5 overexpression and knockdown. ∗∗p < 0.01.(E) Western blot analysis of protein expression levels of TNC, TGF-β1, phosphorylated Smad2/3 (p-Smad2/3), and Smad2/3 in synovial fibroblasts with TBX5 overexpression and knockdown. ∗∗p < 0.01.(F) Immunocytochemical staining of α-SMA, COL-I, and COL-III in synovial fibroblasts with TBX5 overexpression and knockdown. Scale bars, 50 μm.(G) Scratch assay showing the migration of synovial fibroblasts with TBX5 overexpression and knockdown. The bar graph on the right quantifies the migration rate.
Scale bars, 100 μm ∗∗p < 0.01.(H) Quantitative real-time PCR (qPCR) analysis of mRNA expression levels of TNC, TGF-β1, Smad2, and Smad3 in TBX5-overexpressing synovial fibroblasts with and without TNC knockdown. ∗∗p < 0.01(vs. NC-TBX5 group), ##p < 0.01(vs. OE-TBX5+si-TNC group).(I) Western blot analysis of protein expression levels of TNC, TGF-β1, phosphorylated Smad2/3 (p-Smad2/3), and Smad2/3 in TBX5-overexpressing synovial fibroblasts with and without TNC knockdown. ∗∗p < 0.01(vs.
NC-TBX5 group), ##p < 0.01(vs. OE-TBX5+si-TNC group).(J) Immunocytochemical staining of α-SMA, COL-I, and COL-III in synovial fibroblasts under different conditions of TBX5 overexpression and TNC knockdown. Scale bars, 50 μm.(K) Scratch assay showing the migration of synovial fibroblasts under different conditions of TBX5 overexpression and TNC knockdown.
The bar graph on the right quantifies the migration rate. Scale bars, 100 μm ∗p < 0.05, ∗∗p < 0.01(vs. NC-TBX5 group), ##p < 0.01(vs.
OE-TBX5+si-TNC group). n = 3 biologically independent experiments. Data are represented as mean ± SD. Statistical analyses were performed using one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons.
To elucidate the effect of TBX5 on the TGF-β/Smad2/3 signaling pathway, we cultured synovial fibroblasts with ox-LDL and manipulated TBX5 expression. Overexpression of TBX5 significantly upregulated the mRNA and protein expression levels of TGF-β1, Smad2, and Smad3, as well as the phosphorylation levels of Smad2/3, while knockdown of TBX5 inhibited the expression of these molecules (Figures 5D and 5E). Immunocytochemical staining showed that overexpression of TBX5 increased the expression of α-SMA, COL-I, and COL-III, markers of fibroblast activation and extracellular matrix production (Figures 5F and S2D).
Scratch assays revealed that overexpression of TBX5 significantly enhanced fibroblast migration ability, whereas knockdown of TBX5 inhibited cell migration (Figure 5G).
To further validate the role of TNC in TBX5-mediated FS fibrosis, we interfered with TNC expression in TBX5-overexpressing cells. The results demonstrated that TNC knockdown significantly inhibited the TBX5 overexpression-induced upregulation of TGF-β1, Smad2, and Smad3 mRNA and protein expression levels, as well as the increase in Smad2/3 phosphorylation (Figures 5H and 5I). Immunocytochemical staining and scratch assay results further confirmed that TNC knockdown suppressed extracellular matrix synthesis and cell migration in TBX5-overexpressing cells (Figures 5J, 5K, and S2E).
These findings indicate that TBX5 promotes fibroblast activation and migration, thereby exacerbating FS fibrosis, by directly binding to the TNC promoter to upregulate TNC expression, which subsequently activates the TGF-β/Smad2/3 signaling pathway. TNC is an essential downstream mediator of TBX5 in this process.
TBX5 exacerbates hyperlipidemia-induced frozen shoulder fibrosis by activating the TGF-β/Smad2/3 signaling pathway via TNC in vivo
To validate the role of the TBX5-TNC axis in vivo, we established a hyperlipidemia-induced FS rat model and examined the effects of TBX5 overexpression or knockdown on joint capsule histology and fibrosis. The results demonstrated that rats with TBX5 overexpression exhibited a significant decrease in joint range of motion compared to the hyperlipidemia model group (p < 0.05), while rats with TBX5 knockdown showed a significant increase in joint range of motion (p < 0.05) (Figure 6A). Histological analysis revealed a significant increase in inflammatory cell infiltration and collagen deposition in the joint capsules of the TBX5 overexpression group compared to the hyperlipidemia model group (p < 0.05), whereas TBX5 knockdown significantly reduced these pathological features (p < 0.05) (Figures 6B, 6C, and S1D).
Molecular mechanism studies indicated that TBX5 overexpression significantly upregulated the mRNA and protein expression levels of TBX5, TNC, and Itgα2, and activated the TGF-β/Smad2/3 signaling pathway in the joint capsule tissues of the hyperlipidemia model rats (p < 0.05). Conversely, TBX5 knockdown inhibited the expression of these molecules and the activation of the signaling pathway (p < 0.05) (Figures 6D and 6E). To verify whether activation of the TBX5–TNC–Itgα2–TGF-β/Smad2/3 pathway occurs in synovial fibroblasts, we analyzed the expression of synovial fibroblast markers (FN1, VCAM-1, and PDGFR) in rat shoulder joint capsule tissues using qPCR.
Results showed that TBX5 overexpression significantly increased the expression levels of FN1, VCAM-1, and PDGFR, indicating the activation of synovial fibroblasts (Figure S1E). Immunohistochemical staining showed a significant increase in the expression of α-SMA, COL-I, and COL-III in the joint capsules of the TBX5 overexpression group compared to the hyperlipidemia model group (p < 0.05), indicating enhanced extracellular matrix production and fibrosis, while TBX5 knockdown suppressed the expression of these molecules (p < 0.05) (Figure 6F).Figure 6In vivo effects of TBX5 modulation on hyperlipidemia-induced frozen shoulder in rats(A) Shoulder joint range of motion in hyperlipidemic (HL) rats with TBX5 overexpression (HL + OE-TBX5) and knockdown (HL+si-TBX5).(B) Representative hematoxylin and eosin (H&E) stained histological sections of shoulder joint tissues from HL, HL + OE-TBX5, and HL+si-TBX5 rats. Scale bars, 50 μm.(C) Representative Masson’s trichrome stained histological sections of shoulder joint tissues from HL, HL + OE-TBX5, and HL+si-TBX5 rats.
Scale bars, 50 μm.(D) mRNA expression levels of TBX5, TNC, Itgα2, TGF-β1, Smad2, and Smad3 in shoulder joint tissues from HL, HL + OE-TBX5, and HL+si-TBX5 rats, as determined by qPCR.(E) Protein expression levels of TBX5, TNC, Itgα2, TGF-β1, phosphorylated Smad2/3 (p-Smad2/3), and Smad2/3 in shoulder joint tissues from HL, HL + OE-TBX5, and HL+si-TBX5 rats, as determined by western blot.(F) Immunocytochemical staining of α-SMA, COL-I, and COL-III in shoulder joint tissues from HL, HL + OE-TBX5, and HL+si-TBX5 rats. Scale bars, 50 μm. n = 6 biologically independent rats per group. Data are represented as mean ± SD and were analyzed using one-way ANOVA. ∗p < 0.05, ∗∗p < 0.01 and ∗∗∗p < 0.001.
Moreover, to further validate the in vivo function of the TNC/Itgα2 axis, we knocked down TNC or Itgα2 expression via adenovirus injection in hyperlipidemic rat models. Masson’s trichrome staining revealed that, compared to the HL group, the knockdown of either TNC or Itgα2 significantly alleviated collagen deposition in the shoulder joint capsule, demonstrating that targeting TNC or Itgα2 effectively mitigates the fibrotic process in vivo (Figure S1F). These in vivo findings are consistent with our in vitro results and demonstrate that TBX5 exacerbates hyperlipidemia-induced FS fibrosis by regulating TNC to activate the TGF-β/Smad2/3 signaling pathway, further confirming the crucial role of the TBX5-TNC axis in the pathogenesis of FS.
Discussion
The etiology and pathological mechanisms of FS are complex and multifactorial, involving inflammatory fibrosis, neurogenic, vascular, and psychoendocrine factors.22 While the precise underlying causes remain elusive, recent studies have increasingly reported an association between hyperlipidemia and FS, suggesting hyperlipidemia as a potential risk factor.23,24 However, the specific effects of hyperlipidemia on FS development and its underlying mechanisms have been sparsely investigated. In this study, we successfully established a hyperlipidemic rat model and elucidated the role of hyperlipidemia in inducing FS-like pathology in these animals. Based on the clinical stages of FS (painful phase, freezing phase, and thawing phase), the 12-week hyperlipidemic rat model in this study exhibited significant joint stiffness, inflammatory infiltration, and collagen deposition at 8–12 weeks, which pathologically corresponds best to the clinical “freezing phase”.
This stage is characterized by progressive fibrosis and joint contracture, consistent with the dense collagen fiber bundles and fibrous tissue hyperplasia observed in human “freezing phase” FS specimens.25,26
Transcriptomic analysis of joint capsule tissue revealed significant enrichment of DEGs in biological processes related to extracellular structure organization, extracellular matrix organization, and extracellular encapsulating structure organization. PPI network analysis revealed that extracellular matrix (ECM) remodeling represents a core pathological feature of hyperlipidemia-associated FS, involving extensive interactions among collagens (including Col2α1 and Col1α1), integrins (Itgα2, Itgα10, and Itgα11), and fibronectin Fn1. As the primary structural components of ECM, abnormal collagen deposition serves as a direct manifestation of fibrosis.18,27 The collagen family comprises twenty-eight members, with biosynthesis of types I and III collagen increasing several hundred-fold during FS fibrosis, while type V collagen expression is also significantly upregulated.28 Furthermore, neosynthesis of collagen (particularly type V) is closely associated with the expression of elastin, tenascin C (TNC), the collagen cross-linking enzyme lysyl oxidase (LOX), and Wnt1-inducible signaling pathway protein 1; these proteins can be upregulated by TGF-β1 in vitro and are involved in regulating cell proliferation.29 Integrins are heterodimeric glycoproteins composed of α and β subunits, belonging to the type I transmembrane protein family characterized by large extracellular domains, transmembrane regions, and cytoplasmic tails.19 As crucial ECM sensory receptors, integrins play a central role in transducing extracellular signals into intracellular responses and have been demonstrated by numerous studies to participate in fibrotic processes through the TGF-β pathway.30,31 For instance, osteoglycin (OGN) promotes pulmonary fibrosis by enhancing integrin αv expression to activate the TGF-β/Smad signaling pathway.32 Although the integrin-TGF-β axis is well-established in fibrosis, its upstream regulatory mechanisms remain incompletely understood.
The PPI network in this study demonstrates direct interaction between TNC and Itgα2. TNC is an ECM protein involved in tissue injury and fibrotic processes. Previous reports indicate that its promoter can be directly bound by the transcription factor Prrx1, thereby promoting renal fibrosis.33 Our study further reveals that the transcription factor TBX5 regulates TNC expression, and TNC may precisely modulate the TGF-β/Smad signaling pathway through Itgα2, consequently driving the fibrotic progression in the shoulder joint capsule.
Therefore, TNC and its mediated ECM-receptor interaction signaling pathway may play crucial roles in the development of clinical manifestations associated with FS. Cellular component enrichment analysis further highlights the extracellular matrix as the primary site of action for these differentially expressed gene products. Protein interaction network analysis suggests that TNC and its mediated ECM-receptor interaction signaling pathway may represent key mechanisms in the pathogenesis of FS-related clinical symptoms.
Synovial inflammation and joint capsule fibrosis are widely recognized as key pathological processes in FS, with histological studies revealing increased chronic inflammatory cells, including fibroblasts, T cells, and macrophages, in the affected capsule.5 The elevated levels of fibrotic growth factors, inflammatory cytokines, and interleukins observed in FS are likely associated with synovitis.5 The generally accepted understanding is that inflammation and fibrosis of the shoulder capsule are the primary contributors to pain and restricted mobility in this condition. Consistent with these observations, our hyperlipidemic rat model exhibited both inflammatory infiltration and increased fibrosis in the humerus joint and capsule tissue. While the precise mechanisms driving articular fibrosis remain under investigation, activation and transdifferentiation of local joint fibroblasts into myofibroblasts, characterized by α-SMA positivity and the accumulation of extracellular matrix components, predominantly type I collagen, are recognized features.25 In line with these findings, we observed increased α-SMA and type I and III collagen in the HL group, cellular TNC, and ox-LDL treatment groups.
Our integrated transcriptomic analysis, enrichment studies, and PPI network analysis implicated extracellular matrix components and the TNC gene in the development of pathological and histological alterations in FS. We further identified the transcription factor TBX5 as a regulator of TNC expression, binding to its promoter region. TNC, a matricellular glycoprotein with diverse functions, influences collagen deposition, elastin fiber stabilization, and can potentially activate TGF-β signaling, promoting fibrosis, and inflammation.34,35 Supporting our findings, Cohen et al.36 reported significantly higher TNC mRNA expression in the glenohumeral joint synovial membrane/capsule of adhesive capsulitis patients compared to controls, suggesting a role for TNC in promoting capsule inflammation and fibrosis.
Consistent with this, our study demonstrated significantly increased TNC mRNA and protein expression in hyperlipidemia-induced FS tissue, and ox-LDL stimulation induced TNC production in fibroblasts. Furthermore, we observed a significant increase in the transcription factor TBX5 and TGF-β1 gene and protein expression in FS tissues and fibroblasts of hyperlipidemia-induced rats. The TGF-β/Smad2/3 pathway is recognized as a central pathway in progressive fibrosis,37 with sustained TGF-β production being a key driver of tissue fibrosis and disease progression.38,39 Beyond fibrosis, TGF-β participates in various biological processes, including cell proliferation, differentiation, autophagy, apoptosis, and immune response.40,41 Notably, Xue et al.42 demonstrated that Smad4 silencing inhibits chronic inflammation and fibrosis in joint tissues by suppressing the TGF-β/Smad pathway.
Our results also revealed an interaction between TNC and Itgα2, which regulated TGF-β/Smad2/3 pathway activation, promoting fibrotic transformation and collagen secretion in cells.
Although studies have shown that TGF-β and TNC can promote fibrosis, there are few reports on the relationship and mechanism between the two in the development of fibrosis in FS tissue.36,43 To further explore the interaction between TBX5 and TNC as well as the molecular mechanism of TNC in frozen shoulders, we designed in vitro and in vitro experiments. The results of dual luciferase and chromatin immunoprecipitation assays showed that TBX5 could bind to TNC and regulate its expression level. After the addition of overexpressed TNC plasmids into ox-LDL-induced fibroblasts, the expression of TGF-β and p-Smad2/3 proteins increased, as did the expression of fibrotic marker proteins alpha-SMA, Col I, and Col III.
Co-IP assay also revealed a binding effect between TNC and Itgα2. Overexpression of Itgα2 markedly increased the expression of TGF-β and p-Smad2/3 proteins; the expression of α-SMA, Col I, and Col III in cells; and the growth and migration of fibroblasts. TGF-β is considered a key mediator of tissue fibrosis, and it is now widely recognized that TGF-β/Smad signaling transduction is the main pathway for pulmonary fibrosis, liver fibrosis, and renal fibrosis, causing tissue scar formation by activating its downstream paternal anti-Smad signaling transduction.44,45 In fibrosis and cartilage formation studies of primary FS, Hagiwara et al.46 confirmed the dense fibrous bundle structure of collagen formation in the shoulder capsule tissue of patients with FS, while the arrangement of collagen fibrous bundles in the shoulder capsule tissue of patients with rotator cuff injury showed a sparse and orderly structure.
Consistent with these histological observations, our findings further elucidate the molecular basis of this pathological divergence, demonstrating that the TBX5-TNC-Itgα2 axis drives the excessive collagen deposition and fibroblast activation that characterize the dense fibrotic transition in FS capsules.
After overexpression of TBX5, the expression of TGF-β, p-Smad 2/3, α-SMA, col-I, and col-III in fibroblasts induced by ox-LDL increased, and the growth and migration of cells improved. Furthermore, after the addition of overexpressed TBX5 plasmids and TNC-interfering plasmids, the increased expression of TGF-β, p-Smad2/3, α-SMA, col-I, and col-III in the cellular TBX5 overexpressing group was counteracted, suggesting that TBX5 regulates TNC expression and TGF-β/Smad2/3 protein levels by binding to the TNC promoter. Moreover, we constructed TBX5 overexpression- and interference-related virus vectors and intervened in the HL rat model.
After comparison with the HL group, TBX5 interference alleviated the maximum angular retraction of the shoulder joint in rats, improved the inflammatory infiltration of the joint capsule, and the degree of fibrosis and overexpression of TBX5 had the opposite outcome. Molecular changes were detected using PCR, WB and immunohistochemistry assays, and the results were consistent with those of the cellular experiments. After TBX5 overexpression, TNC, Itgα2, TGF-β, and Smad2/3 gene transcription levels increased in the HL + OE-TBX5 group, and the expression of TNC, Itgα2, TGF-β, and p-Smad2/3 proteins increased.
Additionally, the expression of fibrosis markers α-SMA, Col I, and Col III was elevated in the tissues. Thus, TBX5 interference blocked the TGF-β/Smad2/3 pathway by inhibiting TNC to regulate pathway-mediated fibrosis, which may be the regulatory mechanism by which TBX5 inhibits fibrosis-induced frozen shoulders.
This study utilized rheumatoid arthritis synovial fibroblasts (RASFs) as an in vitro model to investigate shoulder joint fibrosis. RASFs serve as a well-validated system for investigating pathological fibrosis, sharing core similarities with FS-derived fibroblasts in terms of pro-fibrotic phenotypes and essential signaling pathways, particularly the TGF-β/Smad cascade.36,47,48,49,50,51 Nonetheless, the application of this model warrants a nuanced interpretation in light of recent biological advances. Recent single-cell sequencing and epigenomic studies have revealed significant heterogeneity within the RASFs population.
RASFs comprise functionally distinct subpopulations that may play different roles in inflammation, invasion, and fibrosis.52 For instance, fibroblasts from the lining and sublining layers exhibit marked differences in gene expression, cytokine secretion, and cartilage-destructive capacity.53 Furthermore, fibroblasts from different joint origins demonstrate site-specific gene expression patterns and signaling pathway activities.54 For example, JAK-STAT signaling pathway activity varies among fibroblasts from different joints, which may influence their responses to targeted therapies.55 This study employed a commercial mixed population of RASFs without distinguishing specific fibroblast subtypes. Therefore, our findings represent the average response of this heterogeneous population to ox-LDL stimulation. Future research applying techniques such as single-cell RNA sequencing to directly isolate and characterize fibroblast subpopulations from the shoulder capsules of FS patients will enable more precise elucidation of this molecular axis in specific cell types, thereby deepening our understanding of the pathogenesis of FS.
In summary, our study demonstrates that TBX5 interference blocks the TGF-β/Smad2/3 pathway by inhibiting TNC binding to Itgα2, which can alleviate inflammation of capsule tissue in rats and inhibit fibrosis in cells and tissues. These findings suggest that the TBX5-TNC-Itgα2 axis plays a significant role in the development of FS characterized by fibrosis and inflammation. Therefore, TBX5 might represent a promising gene target for the treatment of FS, warranting further investigation of its underlying mechanisms and translational potential.
Limitations of the study
Our study has certain limitations. First, the findings are based solely on a high-fat diet-induced rat model; validation in other species would strengthen the generalizability of the TBX5–TNC–Itgα2 axis. Second, although the TNC–Itgα2 interaction was functionally validated, its necessity remains to be confirmed using a function-blocking antibody or inhibitor.
Third, systemic delivery of AAV via tail vein injection may lead to suboptimal viral enrichment in the shoulder joint, warranting future optimization through intra-articular or targeted strategies.56 Finally, given the central role of TBX5 in cardiac development,47 therapeutic targeting requires careful evaluation of potential off-target effects, highlighting the need for tissue-specific delivery systems or safer downstream effectors.
Resource availability
Lead contact
Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Youliang Shen (shenyouliang66@163.com).
Materials availability
This study did not generate new unique reagents.
Data and code availability
•The raw transcriptomics sequencing data generated in this study have been deposited at the Genome Sequence Archive (GSA) database under the accession number CRA053305 and are publicly available as of the date of publication.•This paper does not report original code.•Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Acknowledgments
This research was supported by the 10.13039/100014718National Natural Science Foundation of China (nos. 82472431 and 82401552), 10.13039/100007219Shandong Provincial Natural Science Foundation (no. ZR2024QH590), 10.13039/100032259Shandong Provincial Key R&D program (Science and Technology Demonstration Project) in 2021 (grant no.
2021SFGC0502), Qingdao 10.13039/100010097Science and Technology Plan Project Science and Technology Benefiting the People Demonstration and Guidance Project in 2022 (grant no. 22-3-7-smjk-5-nsh).
Author contributions
Conceptualization was performed by F.J.; methodology was established by F.J., Y.Z., and J.M.; investigation was carried out by F.J., Y.Z., and J.M.; visualization was performed by F.J. and Y.S.; supervision was performed by T.Y. and Y.S.
Declaration of interests
The authors declare no competing interests.
STAR★Methods
Key resources table
REAGENT or RESOURCESOURCEIDENTIFIERAntibodiesAnti-Collagen IAbcamCat# ab6308; RRID: AB_305411Anti-Collagen IIIBiorbytCat# orb10437; RRID: AB_10752785Anti-α-SMABioss AntibodiesCat# bsm-33188MAnti-CD68AbcamCat# ab213363; RRID: AB_2801637Anti-TBX5AbclonalCat# A15590; RRID: AB_2762995Anti-TNCAbcamCat # A3816Anti-TGF-β1ABclonalCat# A21245; RRID: AB_3105906Anti-SMAD2/3AbclonalCat# A7536; RRID: AB_2768063Anti-p-SMAD2/3AbclonalCat# AP0548; RRID: AB_2771541Anti-Itgα2AbclonalCat# A7629; RRID: AB_2863553Anti-Itgα10AffinityCat# DF2539; RRID: AB_2839745Anti-Itgα11AbclonalCat# A10084; RRID: AB_2757608Anti-GAPDHAbclonalCat# A19056; RRID: AB_2862549Secondary antibody (WB)BeyotimeAS014Secondary antibody (IHC)BeyotimeA0208Secondary antibody (IF)BeyotimeA0562Bacterial and virus strainsAAV2-tbx5-2A-3xflagBiomedicineN/AAAV2-2A-3xflagBiomedicineN/ABiological samplesMale Sprague-Dawley (SD) ratsChongqing Ensiweier Biotechnology Co. Ltd.RRID: RGD_7050854 (SD rat)Human blood samples (Serum)N/AN/AChemicals, peptides, and recombinant proteinsHigh-fat dietBeijing Keao Xieli Feed Co., Ltd.N/AOx-LDL (50 μg/mL)SolarbioIO1300TNC recombinant protein (10 μg/mL)MCEHY-P71691DAB substrateZSGB-BioZLI-9019HematoxylinBeyotimeAS1055ADAPIBeyotimeC1005Critical commercial assaysRat TC ELISA kitQuanzhou Ruixin Biotechnology Co., Ltd.RXWB0294-96Rat TG ELISA kitQuanzhou Ruixin Biotechnology Co., Ltd.RXWB0011-96Rat HDL ELISA kitQuanzhou Ruixin Biotechnology Co., Ltd.RX302705RRat LDL ELISA kitQuanzhou Ruixin Biotechnology Co., Ltd.RX302772RELISA Kit for Tenascin C (TNC)Cloud-Clon CorpSEB975RaHuman LDL ELISA KitSangon Biotech Co., Ltd. ShanghaiD711751Human Tenascin-c (TNC) ELISA KitCUSABIOCSB-E13125hiScript cDNA Synthesis KitBio-Rad1708890BCA Protein Assay KitElabscienceE-BC-K318-MDual-luciferase reporter gene detection systemPromegaE1910Deposited dataTranscriptome sequencing dataThis articleGSA: CRA053305Experimental models: Cell linesHuman Synovial Fibroblasts (RASFs)BeNa Culture CollectionBNCC371792Experimental models: Organisms/strainsSD ratsChongqing Ensiweier Biotechnology Co.
Ltd.RRID: RGD_7050854OligonucleotidesqPCR primersSangon BiotechN/ARecombinant DNApGL4.11-WTShanghai Genechem Co.,Ltd.N/ApGL4.11-MUTShanghai Genechem Co.,Ltd.N/ApcDNA3.1-TBX5Shanghai Genechem Co.,Ltd.N/ApcDNA3.1-NCShanghai Genechem Co.,Ltd.N/Ap3×Flag-TNCShanghai Genechem Co.,Ltd.N/ApcDNA3.1-HA-Itgα2Shanghai Genechem Co.,Ltd.N/ApcDNA3.1-HA-Itgα10Shanghai Genechem Co.,Ltd.N/ApcDNA3.1-HA-Itgα11Shanghai Genechem Co.,Ltd.N/ASoftware and algorithmsSPSSIBMVersion 23.0GraphPad PrismGraphPad SoftwareVersion 9.0ImageJNIHVersion 6.7DAVIDNIHVersion 11.0STRING databaseSTRINGN/AAnimal TFDBAnimal TFDBN/AOtherDMEM mediumGibcoC11995500BTFetal bovine serum (FBS)GibcoA5256701OPTI-MEMGibco31985–062Lentifusion Max transfection reagentBioMedicine24765–1TRIzolTakara9109
Experimental model and study participant details
Clinical serum samples
Serum samples from patients with hyperlipidemia(n = 30) were obtained from the Affiliated Hospital of Qingdao University. Normal control samples(n = 30) were collected from healthy individuals who underwent routine physical examinations at the same institution. This study was approved by the Ethics Committee of the Affiliated Hospital of Qingdao University (Approval No.
QYFY WZLL 30838). Informed consent was obtained from all participants before sample collection. The two groups were age- and sex-matched (mean age: 52.0 ± 2.5 vs.
50.5 ± 2.9 years; male/female ratio: 15/15 in both groups), with no significant statistical differences in these baseline characteristics (p > 0.05).
Establishment of a rat model of hyperlipidemia
A total of 72 male Sprague-Dawley (SD) rats (6 weeks old, weighing 180–240 g) were obtained from Chongqing Ensiweier Biotechnology Co., Ltd. The animals were housed in a specific pathogen-free (SPF) facility maintained at 23°C–25°C with a 12-h light/dark cycle and ad libitum access to food and water. Following one week of acclimatization, 36 rats were randomly assigned to either the normal control group or the hyperlipidemia model group (n = 18 per group).
Two groups of animals were fed a standard diet (Beijing Keao Xieli Feed Co., Ltd.) and a high-fat diet (consisting of 75% standard diet, 9% lard, 5.5% egg yolk powder, 7.5% sugar, 2.5% cholesterol, 0.3% sodium cholate, and 0.2% propylthiouracil; Beijing Keao Xieli Feed Co., Ltd.) respectively. And retraction of the maximum outward angle of the shoulder joint (mobility) was observed after modeling at 4, 8, and 12 weeks. Abdominal aortic blood samples were collected to determine the levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL), low-density lipoprotein (LDL), and other blood lipid indicators to evaluate the performance of the model.
Glenohumeral joint tissues were collected, and histological changes were observed. The expression levels of Col I and Col III in the shoulder capsule were detected by immunohistochemistry. At each time point, six SD rats were randomly selected for these assessments.
The remaining 36 rats were divided into three groups: hyperlipidemia model group, hyperlipidemia model + TBX5 overexpression group, and hyperlipidemia model + TBX5 interference group, with 12 rats in each group. The FS model was constructed using the same procedure as that previously described. TBX5 overexpression and interference with adeno-associated viruses were established, and after 12 weeks, adeno-associated viruses were injected via the caudal vein of the model rats (200 μl/each) for intervention, The serotype of the adeno-associated virus is AAV2, with a viral titer of 8.91×1012 vg/mL.
The animals were euthanized 4 weeks after the intervention for subsequent determination. All experimental procedures were reviewed and approved by the Qingdao University Laboratory Animal Welfare Ethics Committee (Approval No. 20230607SD7220240530247).
All animal studies were conducted in strict accordance with the ‘‘Guidelines for Ethical Review of Laboratory Animal Welfare’’ and the ‘‘3Rs’’ principle.
Cell culture
Human synovial fibroblasts for rheumatoid arthritis were purchased from the BeNa Culture Collection (Catalog No. BNCC371792). The cells were primarily isolated from the synovial tissue of a human rheumatoid arthritis (RA) patient and were confirmed by STR profiling.
Fibroblasts were inoculated in a DMEM medium (C11995500BT, Gibco, USA) containing 10% fetal bovine serum (Gibco) and cultured in at 37°C, 5% CO2 incubator (Thermo Science, 184L). Ox-LDL (50 μg/mL) was added to the DMEM medium to prepare a conditioned medium, which was added to the ox-LDL stimulation group for culture. A medium containing 10 μg/mL TNC (HY-P71691, MCE) was added to the TNC group, and an ordinary DMEM medium was used in the control group.
All experiments were performed using low-passage cells (P3-P8) to ensure phenotypic stability.
Method details
ELISA detection of the serum TC, TG, HDL, LDL and TNC levels
Serum concentrations of total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL), low-density lipoprotein (LDL), and Tenascin-C (TNC) were quantified using commercial enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturers' protocols. For rat serum samples, TC, TG, HDL, and LDL levels were measured using ELISA kits from Quanzhou Ruixin Biotechnology (RXWB0294-96, RXWB0011-96, RX302705R, and RX302772R). Rat TNC levels were detected using an ELISA kit from Cloud-Clone Corp (SEB975Ra).
For human serum samples, LDL levels were determined using an ELISA kit from Sangon Biotech (D711751), and TNC levels were measured using a human-specific ELISA kit from CUSABIO (CSB-E13125h). Prior to the assays, all reagents were equilibrated at room temperature for 40 min. The optical density (OD) was measured at 450 nm using a microplate reader.
The concentration of each target was calculated based on a standard curve generated with known concentrations of standards provided in each kit.
Histological changes by HE staining
Appropriate amounts of rat glenohumeral joint and joint capsule tissues were collected, washed with PBS, fixed with polyformaldehyde, and dehydrated using various concentrations of ethanol. The samples were soaked in wax, embedded, and sectioned. Dewaxation, dehydration, staining, and sealing were then performed.
Histological changes in the slices were observed using an inverted microscope.
Masson staining
The joint capsule was fixed with 4% paraformaldehyde and processed in a fume hood. The surrounding tissues were removed and regular cubic tissue blocks were obtained. The blocks were placed in the corresponding dehydration boxes and dehydrated using gradient alcohol.
After paraffin embedding, the tissue blocks were sliced into sections at 5-μm thickness using a paraffin slicer (Leica Biosystems, RM2016) and baked in an oven at 60°C (Shanghai Bluepard Instruments Co., Ltd., DHG-9123A). After dewaxing, the nucleus was stained in telosoumicin compound staining solution for 3 min, Ponceau S soaked for 7 min, and differentiated in phosphomolybdic acid for 3 min. Aniline blue was used to stain the collagen fibers for 5 min, and glacial acetic acid was added for differentiation for 1 min.
Following dehydration in an alcohol gradient, the slices were dried after sealing with neutral gum (Sinopharm, 10004160).
Immunohistochemistry
Tissue sections were immersed in xylene twice for 10 min each time, and after immersion in gradient alcohol, PBS was used for two cycles of washing, each time for 5 min. The slices were immersed in 3% hydrogen peroxide-methanol solution, incubated at room temperature for 10 min, and added with 0.01 M citrate buffer (PH 6.0) for antigen repair. Following the addition of 5% bovine serum albumin by dropwise, the sections were sealed and preserved at room temperature for 30 min, added with Anti-Collagen I (1:200, ab6308, Abcam), anti-Collegen III (1:200, orb10437, Biorbyt), alpha-SMA (1: 200, bsm-33188M, Bioss Antibodies), and cultured overnight at 4°C.
After three cycles of washing with PBS, 5 min each time; secondary antibodies (1:50, A0208, Beyotime) were added and incubated at 37°C for 30 min. DAB substrate (ZLI-9019, ZSGB-Bio) was used for color development for 5 min and was terminated using tap water. Hematoxylin (AS1055A, Beyotime) was added to counterstain the cell nucleus for 3 min, fully washed, dehydrated with gradient alcohol, followed by xylene transparent twice for 3 min each time, and sealed using neutral resin.
Immunofluorescence
The tissue sections were immersed in xylene twice for 10 min each, followed by immersion in a gradient alcohol series. Then, the sections were washed with PBS for two cycles, 5 min each. The slices were placed in a 3% hydrogen peroxide-methanol solution and incubated at room temperature for 10 min.
Antigen retrieval was performed using 0.01 M citrate buffer (pH 6.0). Subsequently, the sections were blocked with 5% goat serum (C0265, Beyotime, Shanghai) at room temperature for 1 h. After removing the blocking solution, the sections were incubated with the fluorescent primary antibody CD68 (1:200, EPR20545, Abcam) at 4°C overnight.
This was followed by incubation with a secondary antibody (1:50, A0562, Beyotime) in the dark for 1.5 h. After three washes with PBS, the nuclei were stained with DAPI (C1005, Beyotime) in the dark for 5 min. The sections were washed again with PBS, mounted with an anti-fade mounting medium (P0126, Beyotime), and imaged under an optical microscope (MF53, Mingmei, Guangzhou).
Bioinformatics analysis
After 12 weeks of hyperlipidemia modeling, three shoulder capsule samples were collected from the rats in the normal group and hyperlipidemia model (FS occurrence) for transcriptomic analysis. Construction and sequencing of the cDNA library of the tissue samples were completed by Novogene Co. Ltd.
After data filtering, expression was calculated based on the FPKM value in the transcriptome sequencing. Genes with FDR values p ≤ 0.01 and fold changes over 2 were considered to be upregulated, while fold changes less than 0.5 were considered to be downregulated. Volcano and heat maps were plotted for differentially expressed genes using the “ggplot2” and “pheatmap” packages, respectively.
In this study, DAVID 6.7 (https://david.ncifcrf.gov/) was used to perform GO and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of the biological processes, cell composition, molecular function, and signaling pathways involved in differential genes in normal and hyperlipidemia model rats. p < 0.05 and FDR <0.05, were used as standard screening to reflect the significance and accuracy of differential gene biological functions. Differential genes were imported into the STRING 11.0 database (https://string-db.org) and a PPI network was constructed to identify interactions and pathway relationships among proteins encoded by the differential genes in the articular capsule. Transcription factors that can bind to the tenascin-C (TNC) promoter region were predicted using the Animal TFDB database, and those differentially expressed in the transcriptome sequencing results were screened and subsequently verified.
qPCR assay
Tissues and cellular RNAs were extracted using TRIzol (Takara, 9109). After sample collection, the RNA concentration and purity were tested using a NanoDrop spectrophotometer (Thermo Fisher Scientific) after 50-fold dilution. Reverse transcription was performed according to the iScript cDNA Synthesis Kit (Bio-Rad, 1708890), and 5 × RT Buffer 4 μL, RT Enzyme Mix 1 μL, and Primer Mix 1 μL were added to each 14 μL sample to make a 20 μL system, and heated at 37°C for 15 min.
Before the PCR loading test, a 20 μL system was constructed by adding 10 μL of SYBR Mixture per well, 1 μL of upstream and downstream primers, and cDNA, and DEPC water was used for quantification at 20 μL. Each sample was added 3 multiple wells. The reaction conditions were as follows: pre-denaturation at 95°C 1 min; denaturation at 95°C 15 s; annealing at 72°C 15 s; and extension at 60°C 15 s.
After 39 cycles, a dissolution curve was obtained. Each group had three wells, with GAPDH as the internal reference. The relative mRNA expression of the indicators was expressed as CT values, which were calculated based on the formula 2-ΔΔCT in each group.
The experimental primer sequences used are listed in Table 1.
Western blot
After three washes with PBS, the joint capsule tissues of the rats were treated with 1 mL of Ripa lysate and 1% PMSF, and ground twice using a grinder, and centrifuged at 12,000 rpm, 4°C for 20 min. The supernatant was collected, proteins were quantified using a BCA (E-BC-K318-M, Elabscience) method, and 5 × SDS-PAGE protein supernatant buffer (8190011128, Siwega) was added at a 4:1 ratio, and the proteins were denatured at 100°C in a metal bath for 5 min. SDS-PAGE was performed using 5% condensed gel and 12% separation gel for protein separation.
Electrophoresis condition were 60 V for 30 min, and after separation of the pre-stained marker (Thermo, 26616) bands, the condition was set to 120V for 60 min. The SDS-PAGE gel was removed, PVDF membranes were prepared and trimmed to an appropriate size, activated using methanol for a few seconds, and then laminated with the gel. Three layers of filter paper were placed on each side, wet with transfer buffer, air evacuated, tightly clamped, and placed in the electrolytic transfer tank.
The condition was set to 200 mA for a membrane transfer of 70 min. After the membrane transference, the PVDF membrane was soaked in a prepared 5% skim milk (MBchem Company), sealed, and gently vibrated on a shaker for 1–2 h; Antibodies were diluted to an appropriate rate as per the antibody instructions, added to a PVDF membrane and primary antibody culture media to an incubation kit, and placed into a thermostatic shaker at 4°C for incubation overnight, The PVDF membrane was removed the next day and rinsed with TBST solution on a shaker (T0192, Taomsun), followed by mild vibration in an incubator with secondary antibodies prepared using antibody and milk at a ratio of 1: 8,000. After 1h of incubation, TBST was used for rinsing three times and The PVDF membrane was developed using the Bio-Rad Chemi Doc imaging system.
Gray values of bands were analyzed using ImageJ software, and the GAPDH grayscale values were used as a reference. Each experiment was repeated three times. The antibodies used were as follows: TBX5 (abclonal, A15590), TNC (Abcam, A3816), TGF-β1 (Abcam, A21245), SMAD2/3 (abclonal, A7536), p-SMAD2/3 (abclonal, AP0548), Itgα2 (abclonal, A7629), Itgα10 (Affinity, DF2539), Itgα11 (abclonal, A10084), GAPDH (abclonal, A19056), and secondary antibodies (AS014).
Co-immunoprecipitation
Human rheumatoid arthritis synovial fibroblasts (RASFs) were cultured for passage in 6-well culture plates. For the co-immunoprecipitation assays, HEK 293T cells were used due to their robust cell growth and exceptionally high transfection efficiency, facilitating the efficient expression of recombinant proteins. When cell density reached approximately 70%, p3 × Flag-TNC, pcDNA3.1-HA-Itgα2, pcDNA3.1-HA-Itgα10, and pcDNA3.1-HA-Itgα11 were transfected according to specific experiments.
After 24 h transfection, the cells were washed three times with pre-cooled PBS, lysed using an IP lysate containing protease and phosphatase inhibitors, and centrifuged at 12,000 × g for 10 min at 4°C. The supernatant was collected and stored at 4°C until subsequent use. Magnetic beads were incubated with the labeled antibody FLAG or HA at room temperature on the rotor for 1 h, washed those bound to antibodies, and incubated with the prepared supernatant at 4°C overnight.
Following the elution of the magnetic beads, the obtained samples were added to a loading buffer at 100°C and boiled for 10 min. SDS-PAGE analysis was performed, and the membranes were transferred for WB blotting.
Cell transfection
Fibroblasts cells in 6-well plates with stable growth were harvested and randomly divided into three groups: an Itgα2 overexpression group, an Itgα2 interference group, and an Itgα2 empty group. Cells were cultured for 4 days in 10 μg/mL TNC medium and treated separately for each group. First, three 1.5 mL EP tubes were prepared, 10 μL of overexpressed Itgα2, interfered Itgα2, and empty-vector Itgα2, respectively, dissolved in 490 μL OPTI-MEM (Gibco, 31985-062), and mixed gently for incubation for 5 min at room temperature.
Another three 1.5 mL EP tubes were prepared and 30 μL of transfection reagent Lentifusion Max (BioMedicine, 24765-1) was added to 470 μL of OPTI-MEM, mixed gently, and allowed to stand at room temperature for 5 min. After 5 min, the mixture in EP tubes containing the transfection reagent was transferred to the corresponding siRNA centrifuge tubes, mixed well, and allowed to stand at room temperature for 15 min. The cells were aspirated completely three times using a 1 mL pipette tip, transferred to 6-well plates evenly, mixed well using a crossing method, and cultured by placing them back in the incubator.
After 6 h, the medium was replaced with complete medium containing 10 μg/mL TNC. Follow-up experiments were performed after 48 h of culturing and cell collection.
Flat panel scratch assay
Fibroblasts (×2,105 cells/well) were seeded into 6-well plates. At 90% confluence, cells were starved for 24 h. A 10 μL pipette tip was used to evenly scratch the Petri dish.
After washing the floating cells with PBS, an inverted microscope was used to observe the scratches at 0 h and recorded. Of 2 mL Complete culture medium was added to each well, and cultured at 37°C with 5% CO2. The scratches were recorded again at 6 h to detect fibroblast migration.
Dual-luciferase reporter system assay
Based on the online predictions, 2,000 bp synthesis at the TNC promoter region was designed and cloned into the dual luciferase reporter vector pGL4.11, which was recorded as pGL4.11-WT; The 2000 bp sequence at the TNC promoter region bound to the C1 mutation and was cloned into the dual luciferase reporter vector pGL4.11 as pGL4.11-mut. The 3′-UTR wild-type (pGL4.11-WT) and mutant (pGL4.11-MUT) reporting vectors of TNC were co-transfected with overexpressed TBX5 control plasmids (pcDNA3.1-NC), overexpressed TBX5 plasmids (pcDNA3.1-TBX5), and the nephrolucinase gene vector pRL-TK (promega), respectively, into HEK 293T cells. After 4 h of transfection, the medium was refreshed, and after 48 h of incubation in at 37°C, 5% CO2 incubator, the supernatant was aspirated.
The cells were washed with at 4°C phosphate buffer and lysed using a cell lysate. Luciferase viability was determined using a dual-luciferase reporter gene detection system.
Chromatin immunoprecipitation (CHIP) assay
HEK 293T cells were cultured and transfected with TBX5 overexpressing plasmids. We utilized HEK 293T cells for this assay due to their high transfection efficiency and suitability for chromatin studies, which are crucial for assessing TBX5’s binding capacity to the TNC promoter. When the cell growth was 80%–90%, ice-cold PBS was used for washing three times.
Then Cross-linking was performed using 1% formaldehyde for 10 min, which was neutralized by adding glycine, and ice-cold PBS was used for washing three times, with incubation for 20 min at 37°C. The cells were incubated for 20 min after ultrasonication. The supernatant was collected; the Anti-TBX5 antibody was added to the experimental group, non-specific IgG was added to the negative control group and incubated at 4°C overnight.
Until the antibodies were bound to the TBX5-DNA complex, the Protein G magnetic beads were added to precipitate the antibody TBX5-DNA complex, and the precipitated complex was washed, eluted, and TBX5-DNA enriched complex was collected. After the crosslinking was reversed, a DNA purification column was used, and the precipitated DNA fragments were enriched. CR analysis of the TNC promoter DNA was subsequently performed.
The binding sites of TBX5 on the 2,000 bp sequence of the TNC genomic promoter region were analyzed using the JASPAR2020 database. Fluorescence quantitative PCR detection and relative quantitative analysis of mutation positions P1 P2and P3in TBX5-DNA enriched complexes. The experimental primer sequences used are listed in Table 2.
Quantification and statistical analysis
The experimental data were processed using SPSS 23.0 and GraphPad Prism 9.0 software, and experiments were performed with three independent replicates, and all results are presented as the mean ± standard deviation (mean ± SD). The exact value of n and what n represents are specified in each figure legend. Student’s t test was applied to compare the statistical difference between the two groups.
One-way ANOVA followed by Tukey’s post hoc test was used to analyze the statistical difference when more than two groups. The difference was considered statistically significant when the p-value was less than 0.05.