INTRODUCTION
Endpoint polymerase chain reaction (PCR) is a traditional method now used for more affordable identification of a targeted gene DNA sequence (Cruz‐Rangel et al., 2022; Gustafson et al., 1993). During the first stage, purified double‐stranded DNA is heated to denature the hydrogen bonds between the nucleotides, separating the sample into single strands (Garibyan & Avashia, 2013). The temperature is then lowered to a temperature conducive for sequence‐specific forward and reverse primers to bind complementary target DNA segments.
In the final stage, the temperature is raised so the polymerase adds nucleotides to the end of each primer (Erlich, 1989). These three stages run for 25–30 cycles, allowing for desired amplification (Lee et al., 2012). Agarose gel electrophoresis is typically used to visualize DNA products (Lee et al., 2012).
While numerous more complex applications of the PCR strategy are common in professional research, the traditional, simpler end‐point approach may be much more accessible for rural healthcare in the US and elsewhere due to less expensive equipment and supplies required.
Allele‐specific (AS) PCR can be used to detect the presence of known DNA sequences of genes from a variety of sources. In this study, it was applied to determine the genotype of human DNA samples for a genetic disease. Cystic Fibrosis (CF) is an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene (Fanen et al., 2014), affecting approximately 80,000 individuals worldwide.
The CFTR gene is located on chromosome 7 and encodes the anion channels responsible for cAMP‐regulated chloride transport across the apical membranes of epithelial cells (Riordan et al., 1989). A healthy CFTR protein works as a chloride ion channel (Rowntree & Harris, 2003). Impaired CFTR function disrupts ion transport and fluid homeostasis in epithelial tissues, resulting in thick mucus, chronic pulmonary infections, and progressive lung damage (Castellani & Assael, 2016).
More than 2100 mutant variants of the CFTR gene have been identified to date (Petrova et al., 2021). Among these, several mutations are commonly associated with CF, including F508del, G542X, N1303K, G551D, W1282X, 1717‐1G → A, R553X, 621 + 1G → T, and R1162X. The W1282X mutation is the sixth most common CFTR mutation worldwide, accounting for approximately 1.2% of mutant CFTR alleles.
It occurs at a particularly high frequency within the Ashkenazi Jewish population (Michicich et al., 2025).
W1282X is designated as a severe Class I CFTR mutation, in which a nonsense mutation introduces a premature stop codon. The resulting premature termination of translation leads to production of a truncated CFTR protein, leading to reduced levels of functional CFTR protein and impaired chloride channel efficiency (Rowe et al., 2007). The mutation arises from a G → A substitution at codon 1282 in exon 23, converting the tryptophan (W) codon TGG into the stop (X) codon TGA (Suzuki et al., 2022) The W1282X mutation incapacitates CFTR function by reduced steady‐state levels of CFTR mRNA and, consequently, levels of CFTR protein, which occurs through a mechanism of nonsense‐mediated decay (NMD) (Wang et al., 2016).
W1282X‐CFTR polypeptides produced despite NMD will most likely have reduced channel activity. This is because the mutation truncates the protein in the second cytoplasmic nucleotide binding domain (NBD2), critical for efficient CFTR function (Wang et al., 2016).
METHODS
Materials
Low‐cost Taq polymerase enzyme was obtained from Syd Labs MB042‐EUT. The 100 bp Gold Bio MW ladder D001‐500 and agarose powder A‐201‐100 were obtained from Gold Biotechnology. A 100 bp DNA Ladder 15628019 and SYBR‐Safe™ DNA gel stain S33102 were purchased from Invitrogen.
The lithium borate electrophoresis buffer LB20‐1 was obtained from Faster Better Media. Oligonucleotide DNA primers were purchased from IDT. Cell samples were obtained from You et al.
(2024).
PCR primers
PCR Reagent Control
As a positive control for PCR reagent functionality, the Rz gene of the Lambda bacteriophage genome was amplified using two Rz gene primers. 1Rz1F was a Rz gene forward primer: 5′‐GATGTATGAGCAGAGTCA CCGCGAT‐3′ and 1Rz1R was a Rz gene reverse primer: 5′‐GAGGGTGAAATAATCCC GTTCAG‐3′ (Table 1). As designed, this produced a PCR product of 395 bases.
DNA Genome Control
As a positive control for CFTR gene DNA sequence integrity, additional published primer sequences were used. PFprim1‐NestF was a published forward primer: 5′‐GGTCAGGATTGAAAGTGTGCA‐3′ and PRprim1‐URP was a published reverse primer: 5′‐CTATGAGAAAACTGCACTGGA‐3′. As designed, this produced a PCR product of 471 bases (Table 1).
DNA primer sequences were obtained from Feriotto et al. (2001).
Nested‐PCR
A nested PCR strategy was employed using the forward primer sequence, PFprim1‐NestF: 5′‐GGTCAGGATTGAAAGTGTGCA‐3′ and reverse primer sequence, DNestR1: 5′‐AACCTGGCGATTGCTAACTTG‐3′. As designed, these primers amplified a 651‐base template region (Table 1 and Figure 1). DNA primer sequences were obtained from Feriotto et al.
(2001).
Allele‐specific primer design
Allele‐specific primers were designed according to Hidenobu Yaku's intentional single base pair 3′ substitution strategy when targeting SNPs with endpoint PCR (Yaku et al., 2008). A mechanistic diagram is provided to illustrate how non‐specific amplification is suppressed (Figure 1).
AP‐PCR
Allele‐specific primers were designed following the Yaku steric method of introducing intentional base pair mismatches near the 3′ end. A wild‐type forward primer sequence WTF‐Yaku‐1: 5′‐TACATAACTTTGCAACAGGGG‐3′, and a mutant forward primer sequence MF‐Yaku‐1: 5′‐TCAATAACTTTGCAACAGCGA‐3′ were designed to work with a universal reverse primer: 5′‐CATTGAGAAAACTGCACTGGA‐3′ and produce a 190‐base PCR product (Table 1 and Figure 1).
Cell culture
S9 is a stable cell line that expresses the W1282X‐CFTR gene. S9 cell lines were grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 100 units/mL penicillin, and 10 μg/mL streptomycin.
DNA purification
Purified genomic DNA samples were obtained with the use of Chelex‐100 resin. A 10% stock solution of Chelex‐100 resin was composed of 0.10 grams of Chelex resin in 1.0 mL of DNase‐free water. A 1.5 mL sample of approximately 1 × 106 cells was centrifuged at 14000 rpm for 2 min until a pellet was formed.
Supernatant was removed, and a solution of 500 μL of 10% Chelex was added and vortexed until the pellet was resuspended. The sample was incubated in a 56°C water bath for 10 min and was vortexed for 5 s every 5 min. After 10 min, the sample was placed into a 100°C bath for 5 min.
The solution was centrifuged one last time at 14000 rpm for 5 min to form a Chelex pellet. The supernatant containing purified DNA was separated from the Chelex pellet and stored at −20°C until use. A 260/280 analysis was performed to measure nucleic acid concentration and purity of DNA samples.
Polymerase chain reaction
To conduct PCR, a 50 μl cocktail was created using 35.8 μl of nuclease‐free H2O, 5.0μl of 10× PCR buffer (200 mM Tris–HCl (pH 8.4) and 500 mM KCl), 1.5 μl of 25 mM MgCl2 and 1.0μl of each; 10 mM dNTP's, 100 μM forward primer, 100 μM reverse primer, 1ug/μl DNA template, and 5 U/μl taq polymerase. A T100 Bio‐Rad thermal cycler was used. An initial denaturing temperature of 95°C was used for 3 min.
Thirty cycles were used with: (1) a denaturing temperature of 95°C for 30 s, (2) an annealing stage for 45 s, (3) a polymerization temperature of 72°C for 1 min.
Gel electrophoresis
A 1% agarose gel was used to perform gel electrophoresis. The materials included 0.5 g of agarose, 2.5 mL of LB 20× (200 mM lithium borate) buffer, 47.5 mL of dH2O, and 5 μL of 10,000× SYBR‐Safe™ dye. The mixture of dH2O, 20× LB buffer, and agarose powder was warmed in the microwave until dissolved.
After the mixture was cooled slightly, SYBR‐Safe™ dye was added, and the gel cast. 6X loading dye containing 30% glycerol, 0.25% (0.025 g/10 mL) bromophenol blue, and 0.25% (0.025 g/10 mL) xylene cyanol was used during loading of samples. A 1X LB running buffer solution was used during electrophoresis at 150 V for 30 min.
The gel was analyzed and photographed under UV light.
Data analysis
Gel electrophoresis was analyzed by comparing the migration of bands in the molecular weight ladder to those of PCR products using a semi‐logarithmic plot. A trendline was added and an R2 value was obtained. The trendline equation was used to calculate PCR product base‐pair lengths.
RESULTS
An allele‐specific PCR assay for the detection of the W1282X CFTR mutation was designed for evaluation alongside control PCR primers (Table 1). Allele‐specific primers were designed using the Yaku steric mismatch strategy (Figure 1).
Evaluation of PCR reagents
A Rz gene positive control was used regularly to assess the functionality of reagents and was designed to produce a single band of 395 base pairs (Figure 2). In the sample gel highlighted, a single band was observed at the migration distance of 2.767 cm. To calculate the base pair (bp) length of the PCR product, the molecular weight ladder was used as a reference.
From the measurements taken, a semi‐logarithmic graph was generated, and the PCR product was calculated to be approximately 396 bp (Figure 2b). The close correlation between the observed migration distance and the predicted fragment length supported the functionality of the endpoint PCR reagents and protocols.
Assessment of purified DNA
Genomic DNA extracted from human buccal epithelial cells was evaluated by UV–Vis spectrophotometry. DNA yield and purity varied between trials; however, trial 3 produced the highest concentration (207 ng/μL) and the most favorable A260/280 ratio (1.59), consistent with acceptable protein‐free genomic DNA. This sample was selected as the wild‐type CFTR template for subsequent control and allele‐specific PCR assays.
Verification of CFTR locus integrity
PCR amplification of the exon 23 region using primers “Fprim‐1” and “URprim‐1” was used to verify the presence of wild‐type CFTR genomic DNA in purified samples. In gel electrophoresis, amplification of genomic DNA produced a single band migrating near the expected position for a 471 bp amplicon in gel electrophoresis (Figure 3). Semi‐logarithmic analysis yielded a line of best fit equations to calculate the base pair length of the amplified DNA (Figure 3b), where y represents the migration distance (2.403 cm) and x represents the molecular size.
A calculated fragment size of 472 bp (Figure 3b) supported the predicted amplicon was obtained. A schematic of primer annealing in introns 22 and 23 is provided (Figure 3c).
Allele‐specific amplification
Experimental PCR analysis demonstrated strong allele specificity consistent with predicted outcomes. When wild‐type–seeking primers were paired with wild‐type CFTR template, a single ~190 bp amplicon was observed, with no detectable amplification from W1282X mutant DNA (Figure 4). In contrast, mutant‐seeking primers produced a single ~190 bp band exclusively from W1282X mutant template, with complete suppression of amplification from wild‐type DNA (Figure 5).
These mutually exclusive amplification patterns support allele discrimination by the designed primer sets. The molecular basis for this selectivity is illustrated in Figure 1, which illustrates how intentional mismatches at the three 3′ terminal (referred to as X, Y, Z) primer positions inhibit 3′‐end extension on non‐target alleles while permitting extension on correctly paired templates. To confirm product identity, migration distances of allele‐specific amplicons were analyzed using semi‐logarithmic regression relative to molecular weight ladder standards.
Both wild‐type–specific and mutant‐specific PCR products resolved to calculate fragment lengths of approximately 190 bp, consistent with predicted amplicon size (Figure 4). This analysis validates the identity of products observed on agarose gels (Figure 5) and supports steric mismatch‐based discrimination. The primer–template interactions responsible for these validated outcomes are summarized schematically.
Validation of methodology
A PCR forward primer targeting the G542X locus (ΔMF‐Yaku1) and a universal reverse primer (ΔPRprim1‐URP) were used in a PCR amplification to identify the G542X‐CFTR mutation in human genomic DNA as a validation. In gel lanes 3 and 4, with primer annealing temperatures of 59.3°C–62°C, an amplified band at ~300 bp was produced at the anticipated position (Figure 6a). A line of best fit equation was generated from the semi‐logarithmic analysis, where y represents migration distance and x represents the molecular size in base pairs.
The migration distance of 1.905 cm yielded a calculated band size of 295 bp (Figure 6b).
DISCUSSION
A recent “2026 Grand Challenges” initiative from the Gates Foundation sought to find Cost‐Disruptive Tools for Diagnosis, given that limited access to affordable diagnosis is a significant barrier to disease control in the world. This, of course, impacts both rural areas of the US, as well as low‐ and middle‐income countries. Thus, exploring and optimizing some traditional diagnostic approaches, which have become much more affordable, such as endpoint PCR, was explored in this study.
Polymerase Chain Reaction (PCR) is a method used for replication of a targeted DNA sequence using forward and reverse primers (Cruz‐Rangel et al., 2022). In recent decades, the costs associated with endpoint PCR have decreased significantly, making it a more accessible diagnostic. Yet in genetic diseases, a single‐base polymorphism (SNP) mutation is common and more difficult to diagnose with endpoint PCR.
This study utilized more affordable endpoint PCR in a fashion to enhance DNA amplification sensitivity and SNP specificity by incorporating primary nested PCR products with sterically designed Yaku steric primers. Hidenobu Yaku's allele‐specific primer strategy (Yaku et al., 2008) was applied to design wild‐type and mutant forward primers that included a deliberate mismatch at the third position from the final 3′ terminal base. The primer's 3′ base is aligned with the SNP and confers base‐pair specificity.
It was hypothesized that combining steric‐designed primers with nested PCR products would yield an accurate diagnostic assay for not just the W1282X CFTR mutation, but all point mutations. This study was intended as a proof‐of‐concept evaluation of allele‐specific endpoint PCR that could discriminate against the W128X SNP using conventional molecular laboratory equipment. By relying on a standard endpoint thermal cycler and agarose gel electrophoresis, the assay was developed with cost‐conscious implementation in mind and can provide a foundation for further optimization of reagent use and assay cost.
Cystic Fibrosis is an autosomal recessive genetic disorder frequently caused by SNP mutations in the cystic fibrosis transmembrane conductance regulator gene (Fanen et al., 2014). Impaired CFTR function disrupts ion transport and fluid homeostasis in epithelial tissues, resulting in thick mucus accumulation, chronic pulmonary infections, and progressive lung damage (Castellani & Assael, 2016). This disease affects approximately 80,000 individuals worldwide (Farinha & Callebaut, 2022).
The W1282X SNP mutation is the sixth most common CFTR mutation worldwide, accounting for approximately 1.2% of mutant CFTR alleles (Michicich et al., 2025). The mutation arises from a G → A substitution at codon 1282 in exon 23, converting the tryptophan (W) codon TGG into the stop (X) codon TGA (Suzuki et al., 2022). This premature stop codon results in a truncated CFTR protein, impairing chloride ion transport across epithelial membranes and contributing to the clinical manifestations of cystic fibrosis.
Experimental design
This study aimed to aid the development of cost‐efficient allele‐specific primer strategies for detecting single‐nucleotide mutations using the more accessible conventional endpoint PCR in healthcare facilities worldwide. We hypothesized that allele‐specific primers designed using Yaku's intentional base pair mismatch steric strategy could selectively amplify DNA containing the W1282X mutation while preventing amplification of non‐matching wild‐type sequences. Detection reliability was enhanced through the use of a two‐strategy PCR approach.
Primary PCR utilized designed nested forward and reverse primers (DnestF‐1 and DnestR‐1) to enhance the accuracy of the diagnostic test by creating a 591‐base template of the CFTR gene to be targeted in secondary endpoint PCR. Following initial amplification, secondary PCR employed designed wild‐type and mutant forward primers (WTF‐Yaku‐1 and MF‐Yaku‐1) alongside the universal reverse primer (URprim‐1) targeting the nested product. Allele‐specific primer design ensured that WTF‐Yaku‐1 annealed exclusively to the wild‐type DNA, whereas MF‐Yaku‐1 annealed exclusively to W1282X mutant template DNA.
Prior research from the You et al. group was successful in detecting the W1282X mutation (You et al., 2024). This study was pursued to further test accessible strategies on the same SNP.
Ultimate findings
As a reagent control, the Rz gene of the lambda viral bacteriophage genome was amplified. A ~395 bp PCR product supported that the PCR reagent functional status was nominal.
As a template control, the CFTR gene of human purified genome was amplified with PCR primers (Fprim‐1 and URprim‐1) published by Feriotto et al. (2001). Successful amplification of a ~472 bp PCR product supported genome integrity as intact.
A PCR approach was designed to successfully integrate a nested primer step with allele‐specific Yaku‐designed primers to support the detection of the W1282X mutation with endpoint PCR. Following generation of the 591 base pair nested PCR product, secondary PCR amplification with the designed primers produced allele‐specific bands that were visualized by gel electrophoresis. Analysis of the gel under the UV transilluminator revealed bands around 190 base pairs, which were further confirmed by semi‐logarithmic analysis.
The results were supportive of W1282X‐CFTR SNP allele‐specific detection using the combined two‐strategy PCR approach in endpoint thermal cyclers. This approach was then successfully validated via replication with another SNP mutation, the G542X‐CFTR SNP.
Future directions
This assay can be expanded to distinguish wild‐type and mutant alleles associated with other genetic diseases, particularly those caused by point mutations. In addition, this builds upon prior work by the You group, which also successfully targeted the W1282X locus with endpoint PCR. The present study used a different primer configuration and a shorter expected amplicon size, further supporting the idea that endpoint assay designs may be effective for affordable diagnosis.
Because this approach relies on affordable PCR and gel electrophoresis rather than more advanced instrumentation, it may provide a more accessible and cost‐effective option for SNP screening in many clinical‐based laboratories with limited resources in the US and elsewhere. Overall, these findings support the continued development of allele‐specific PCR strategies for practical genetic mutation detection for human, bacterial, and viral DNA sequence targets in diagnosis.
AUTHOR CONTRIBUTIONS
John A. Torok IV: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Derrick L.
Brown: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Michael R. Grassl: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision.
Samyuktha Vijayakumar: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Kierin P. Patel: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision.
Ayaan Jehangir: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Jay Katti: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Daniel F.
Barnas II: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Logan P. Dooley: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision.
Anahita Dhar: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Chase A. MacDougall: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision.
Ryan J. Ciacci: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Siersha R.
Torres: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Nicole Katrib: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision. Douglas Luckie: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision.
FUNDING INFORMATION
Our CF and STEM learning laboratories are supported by Cystic Fibrosis Foundation and Pennsylvania Cystic Fibrosis Inc. grants (to D.L.) for our physiology research program and by grants from the National Science Foundation (to D.L.) for our education research program.
CONFLICT OF INTEREST STATEMENT
No conflicts of interest, financial or otherwise, are declared by the authors.
ETHICS STATEMENT
No human or animal participants were involved in this study.
ARTIFICIAL INTELLIGENCE GENERATED CONTENT (AIGC)
No generative artificial intelligence tools were used in the preparation of this manuscript.